[00:23:30] [discord] I think the only wikipedia code I pilfered was the ambox/messagebox stuff, and that's mostly because I was going to use the Arguments module too anyway so hey why not bring that over in one big heave-ho. [00:24:04] [discord] (I just... need to figure out lua now.) [00:40:48] [discord] There's an official tutorial here: https://www.lua.org/pil/1.html [00:40:48] [url] Programming in Lua : 1 | www.lua.org [00:42:42] [discord] Ahhhhh... The main issue is that my brain doesn't work with step-by-baby-step tutorials. [00:43:33] [discord] It's why I also only learned JSON when I was coding Minecraft extensions for Origins [00:44:01] [discord] (the curse of neurodivergence and ADHD) [00:44:24] [discord] Lua syntax is pretty simple so you can probably just hit the ground running [00:45:00] [discord] The only weird behavior to me are tables and metatables [00:45:01] [discord] if you are in high school that condition seems very common since the tiktok era [00:46:03] [discord] (just to say you are not alone in this case, it happens to me too ) [00:46:04] [discord] I was in high school in 2004 and I've avoided tiktok and vine and all those annoyingly short videoclip sites like the plague [00:46:43] [discord] Mostly because my ADHD's the "forget the world exists for 6 hours and wonder why I have a hunger headache" type ahahahaha [00:47:55] [discord] once I get the squirrels in my brain to focus woe be anything that's not The Zone [00:48:53] [discord] that... is just not how that works at all, those 2 things are not related in any way shape or form [00:51:35] [discord] Why is it part of the template "Digital media use and mental health" on Wikipedia? [00:51:48] [discord] Why is [ADHD] * [00:51:59] [discord] [00:53:37] [discord] Some of my "learn LUA" problems are that "get brainsquirrels to focus" issue-- between procrastinating and the simple fact I keep distracting myself with remembering OTHER stuff I'm doing too, it's... Well, it's the reason why I haven't learned Japanese in-depth either and I have about 500GB of backlogged games [00:56:27] [discord] Distract yourself from other things by learning lua [00:57:33] [discord] ahahahaha yeah I've had success with that tactic, now I just need a task I want to do less to sell to my brainsquirrels... hmmm. [00:59:42] [discord] Why the heck should I know, but what I do know, is that it is a VERY complex subject, of which our understanding of have changes a lot over the years, so I would not expect an wikipedia article to be all that accurate on it in the first place, and on top of that wikipedia templates are complex AF as well, so yeah not sure what you are getting at, but for certain you don't "get" ADHD because of a certain kind of tech or so [01:00:53] [discord] I mean with the limited amount I have looked into Lua (but having general programming knowledge already), that is exactly the issue with Lua, it is too simple, that it would also seems like it would be extremely error-prone [01:01:18] [discord] I'm gonna take a wild guess on that question and go "probably related to the wiki-walking where I start with one page and then I'm 30 tabs richer and went from wanting to know how humans see colors to how salps function as a collective organism" [01:04:28] [discord] The information age makes it *incredibly* easy for my executive dysfunction to kick in because of all the interesting things at my fingertips and the fact I often forget to stop myself in time. [01:05:24] [discord] I've gotten better at it now that I *actually* know I do it, but it's still impulsive to go look. [01:06:14] [discord] Anyway, I'm going to distract myself from going offtopic further and see if I can understand that whole invoke thing [01:07:11] [discord] OH scribunto has a tutorial on it! [01:09:05] [discord] I could kiss whoever wrote the Scribunto tutorial they're not tripping over jargon and sounding like an MS-dos user manual [01:10:27] [discord] Auuuuuugh it's full of red links [01:43:09] [discord] I think it's perfectly fine for a scripting language, since you're not really building an entire application out of it. Especially here in MW, I haven't found a case to do something super complicated. I would have preferred something like Python due to its standard library (and my own familiarity), but it's just a convenience thing over anything else. [01:49:31] * Naleksuh send reception123 [01:49:43] * Naleksuh send cosmicalpha [01:51:19] Hmm? [01:52:07] Sorry lol I typed /me instead of /ms [01:56:20] [discord] I'm *so close* to getting how passing arguments works. okay so for invoke, it's passing the arguments it gets *to* the template sharing `#invoke`'s name? [01:57:10] [discord] Like `#invoke:rainbow` will put the parameters it gets into `template:rainbow`? [01:57:25] Does anyone know who the secret meta sysop that is supposedly backing up actions offwiki is? [02:00:29] [discord] otherway around, template passes its params to the invoke call, plus you can skip the template part altogether and just invoke a module [02:01:22] [discord] Meta or TestWiki? [02:02:22] [discord] ...okay so then I'm right back to where I was: *how does it know where to put its stuff down* [02:03:44] [discord] There's got to be *something* that goes "display it this way" and for the life of me I can't find a *single* example of that part of invoking. [02:04:25] [discord] It can't just be literal magic [02:04:58] Oh Agent is still here? [02:05:06] @Agent Are you talking to me? [02:05:11] I mean both [02:08:44] [discord] ``{{#invoke:module|fn|...}}`` module is module name, fn is the function that called within the module, and ... is your parameters. [02:08:44] https://meta.miraheze.org/wiki/%23invoke:Template:module [02:08:44] [discord] In this case, you'd create the module "module". In that module you'll create a table and give it the function "fn". Within fn, you'll need to accept a frame object and from there you can grab the args. [02:08:54] [discord] Is that what you want to know? [02:09:49] [discord] ....No? What I want to know is more the "make it show up on the page with this appearance" [02:10:05] [discord] Oh, that's just what get returned from "fn" [02:11:01] [discord] Like, the end stuff. I've managed to understand how to put things *into* a module, but then it. [02:11:11] [discord] I don't get how it comes *out* [02:12:20] [discord] Like... I can't find anywhere that explains "now spit it out into *this*" [02:12:28] [discord] Naleksuh: I’m going to ask that you refrain from commenting any further on my talk page on testwiki unless you have something constructive to add [02:13:06] [discord] You are a bureaucrat and have limitations to your authority. Please leave actions regarding user rights restrictions to consuls. [02:13:13] [discord] Do you have an example of where you're facing this problem I don't want to misunderstand again lol [02:13:24] [discord] As an example: how would I use Module:Arguments to spit it out into a template. [02:13:34] [discord] I’d prefer not to get into an argument, so I ask you respect my request [02:13:35] [discord] Thank you [02:14:34] [discord] As in, invoke arguments? [02:15:46] [discord] uh... *kinda*. I know how to invoke it, but I need to tell it "take the arguments and put them here" [02:16:02] [discord] where's "here" [02:16:02] [discord] And I do not know how to do that part at all [02:17:15] [discord] that's... that's actually the point I'm trying to find. the "where's here" [02:18:39] [discord] I haven't actually directly invoked Module:Arguments ever, I only import it to use the "getArgs" function to grab the arguments passed in [02:18:54] [discord] https://en.uncyclopedia.co/wiki/Miraheze [02:18:54] [url] Miraheze - Uncyclopedia, the content-free encyclopedia | en.uncyclopedia.co [02:18:55] [discord] LMAO [02:19:02] [discord] should probably put that in #ID:615786602454581249 [02:19:21] [discord] but pretty funny [02:19:58] [discord] okay so. What I want it to do: take Template:Profile, pass its arguments to one of three templates: CharacterWithMultipleForms, CharacterGroup, CharacterNothingSpecial. [02:20:40] [discord] Depending on if argument 1 is going to be "multiform", "group", or anything else. [02:20:57] [discord] I can figure out that point. [02:21:16] [discord] So you want to use the output of one template to become the input of another? [02:21:24] [discord] But I don't know how to get the arguments into the final templates [02:22:19] [discord] I want the arguments to be passed as another template's input yes [02:23:07] [discord] I can figure out the condition part but not the final "now put them in here" [02:23:10] [discord] The only way I can think of is to serialize the results of Profile and unserialize that in your other templates [02:23:47] [discord] Was your goal to use Profile as a container of several properties like in OOP languages? [02:27:16] [discord] My final goal is basically a character infobox that can handle: a character who has multiple character infoboxes and tabs between them all, a character who has multiple appearances but isn't multiple people, and a normal character that isn't either of the previous. [02:29:05] [discord] One way you can do it is have a singular module that calls other modules, gets those results, and combines them into a singular result [02:30:32] [discord] ...I'm really explaining myself poorly [02:32:34] [discord] I think I'm fixating on "BUT HOW DOES IT COME OUT" [02:32:38] [discord] the image on my wiki fail to load even if clicking the Original file shows it [02:32:38] [discord] https://cdn.discordapp.com/attachments/407537962553966603/1073793656227647498/image.png [02:36:35] [discord] Character infobox is a wrapper for other infoboxes correct? [02:36:46] [discord] Ah crap I closed the reply [02:37:21] [discord] reply eetn sympathies sent [02:38:55] [discord] Also I think that what I'm asking is "how do you get HTML from LUA", or whatever it is that takes LUA and in the end spits out the thing I can style. [02:40:11] [discord] Ah, MW has this library for Lua called mw.html that you might want to check out. It's in the scribunto documentation [02:40:54] [discord] Once you have your finished mw.html tree you turn it into a string and return it [02:41:07] [discord] ohhhhhhh [02:41:23] [discord] *that's the part of the puzzle I was missing* [02:41:50] [discord] Also thank you *so much* for all the other questions you answered, my good human. [02:42:07] [discord] np [02:43:27] [discord] If I was a magician I'd conjure you the best honey bread ever as thanks [02:44:29] [discord] the thumbnail failed to generate and the links said in the QA I cannot change since it is hosted on miraheze [03:09:02] [discord] Fixed. [05:15:49] [discord] https://cdn.discordapp.com/attachments/407537962553966603/1073834725451501598/image.png [05:18:34] [discord] Oops ... did not mean to post but all the same was just am embarrassed. was making a scrapbook of my a good day at Miraheze [05:59:11] [discord] uh [05:59:11] [discord] ok [05:59:13] [discord] lmao [07:38:43] [discord] Did you press the F5 key on the computer? [10:03:01] [discord] How to modify the logo, in :settings? [10:08:38] [discord] Oopsie ^^ [10:08:45] [discord] [10:35:54] [discord] Is it possible to use Axios with Mediawiki commonjs? [11:14:54] [discord] @Adenin Konas 1 month is not long enough to wait [11:15:28] [discord] You need to wait at least 3 [11:15:53] [discord] Global sysop should really be a nomination though [13:07:45] [discord] if you import it through jsdelivr, yes I think [13:08:07] [discord] but if someday MW updates common.js to ES6 I would just use fetch() for that [14:42:16] [discord] Dear admins, while browsing the #global-wiki-feed channel https://wiki.creaturathegame.com/wiki/XCG:ATGTAGCCTAGCGCTTTTACTTTTTTTATACTACTACTGTCGTCGTCTGACCAAGATACTTCTACTGAAGCAGCAGCTGAGACAAACGCAAGCACAAGTAGCTAGGAGAGTCGGGATGAGATAGATGATGATGATGATGATGATGATGAT. This bot loads irrelevant and irrelevant images, I came across a bot integrated using a wikimedia fork template. Please stop this bot. [14:42:17] [url] XCG:ATGTAGCCTAGCGCTTTTACTTTTTTTATACTACTACTGTCGTCGTCTGACCAAGATACTTCTACTGAAGCAGCAGCTGAGACAAACGCAAGCACAAGTAGCTAGGAGAGTCGGGATGAGATAGATGATGATGATGATGATGATGATGAT - Creatura Wiki | wiki.creaturathegame.com [14:43:01] [discord] This bot generates articles and uploads images per minute, and loads Miraheze. Please stop this bot. [14:43:19] [discord] @CosmicAlpha @Agent [14:47:28] [discord] You can find his contributions here; https://wiki.creaturathegame.com/wiki/Special:Contributions/Creaturawikibot [14:47:30] [url] User contributions for Creaturawikibot - Creatura Wiki | wiki.creaturathegame.com [14:49:03] [discord] I'm sorry if his contributions seem a bit encyclopedic to me, but these spam articles are capable of causing unnecessary load on Miraheze servers, I would like to say that. [14:52:30] [discord] That's not an explicit violation of any policy [14:56:24] [discord] The wiki has been seen before and noted, it's done for a purpose - it's just not immediately evident [14:56:38] [discord] look at it in dna sequencing terms [14:57:00] [discord] believe me, if it was causing particular notable strain on miraheze servers, sre would be onto them [15:00:32] [discord] Since our servers are not extensive servers like wikimedia, I think it puts a lot of load on the server. [15:00:50] [discord] But thanks anyway. [15:01:26] [discord] Hmm, thank you raidarr [15:01:34] [discord] I believe it was previously deleted for excessive resource usage, but it was undeleted by Trust and Safety [15:02:08] [discord] If that is the case then Owen would probably be best to inquire to for background [15:02:50] [discord] It was closed because of a misunderstanding but ultimately it's full closure could've been justified if the CP were to have been invoked when it was originally closed and not the ToU [15:04:35] [discord] ToU? [15:04:45] Terms of use [15:04:51] [discord] [[ToU]] [15:04:51] https://meta.miraheze.org/wiki/ToU [15:04:52] [discord] [15:04:52] [url] Terms of Use - Miraheze Meta | meta.miraheze.org [15:05:04] [discord] Thank you MacFan4000. [15:05:43] [discord] MacFan4000 preceded you, Game over 😄 [15:05:59] [discord] eh, different utility [15:06:13] [discord] yeah but I showed you the wikilink to show you that you could've searched it on Meta [15:07:14] [discord] You don't need to show a link as I've already read the Terms of Use. [15:07:34] [discord] I just wanted the expansion of ToU that's all 🙂 [15:37:48] [discord] when was irc and general merged? [15:38:18] [discord] wow [15:38:27] [discord] this server looks different [15:44:38] [discord] yep, threw me off for a minute too [15:45:40] [discord] @raidarr It is with great sadness that I learned of your resignation from wiki creator 😦 I think 2nd retirement. [15:46:20] [discord] indeed, that was primarily because I didn't expect to be around until well after the inactivity removal period [15:46:36] [discord] even now it's for the best, need to chill before I try to be an operative anywhere [15:48:52] [discord] Your 1-year Miraheze adventure inspires me. It was sad that you left us on this road from steward to retirement 😦 maybe I could find new inspiration. [15:49:16] [discord] I did a bit much too quickly, at a time when my personal life was hectic [15:49:28] [discord] anything I do needs to be more balanced and sustainable [16:04:07] [discord] Hey @raidarr [16:05:48] [discord] o7 [17:50:57] [discord] hi! [17:52:09] [discord] g'day [17:54:12] [discord] So, when do you think you'll start contributing on Miraheze proper again [17:54:43] [discord] I don't expect to be very useful for a month at the moment, the minimum is having my infrastructure properly rebuilt [17:55:11] [discord] may log in at some point and do minor things from time to time [17:55:55] [discord] OK, glad to have you back! [17:58:06] [discord] Ye, I'll be able to drop my 2c sometimes at least [18:22:20] [discord] ._ [18:22:21] [discord] [18:22:22] [discord] [18:22:24] [discord] [18:22:25] [discord] [18:22:26] [discord] [18:22:28] [discord] [18:22:29] [discord] [18:22:30] [discord] [18:22:32] [discord] [18:22:33] [discord] [18:22:34] [discord] [18:22:35] [discord] [18:22:37] [discord] [18:22:38] [discord] [18:22:39] [discord] [18:22:41] [discord] [18:22:42] [discord] [18:22:43] [discord] [18:22:44] [discord] [18:22:46] [discord] [18:22:47] [discord] [18:22:48] [discord] [18:22:50] [discord] [18:22:51] [discord] [18:22:52] [discord] [18:22:54] [discord] [18:22:55] [discord] [18:22:56] [discord] [18:22:58] [discord] [18:22:59] [discord] [18:52:18] [discord] out of curiosity [18:52:21] [discord] https://cdn.discordapp.com/attachments/407537962553966603/1074040210431688764/image.png [18:52:22] [discord] bug? [19:03:44] [discord] dark mode is quite bleh [19:03:51] [discord] Yeah, its hit or miss [19:25:56] [discord] Pretty normal behavior if the skin wasn't made with dark mode in the first place [19:31:50] [discord] tbh it’s just miss [19:32:32] [discord] lol true [20:50:34] [discord] if a wiki is not used will it get ? [20:51:13] [discord] After 6 months of no use, yes [20:51:21] [discord] can it be restored? [20:51:51] [discord] We don't typically delete wikis every 6 months on the dot, generally it's like a few months after the 6 month mark [20:52:01] [discord] Usually, we keep backups of wikis so we can typically restore a wiki [20:52:03] [discord]